WP6 Barcode Sequencing

T6.2 Metabarcoding for Biomonitoring

Invertebrate characterization

from bulk arthropod samples

Lab Standard Operating Procedure (SOP)

BIODIVERSITY GENOMICS EUROPE

receives funding from the European Union's Horizon Europe Research and Innovation Action.

https://biodiversitygenomics.eu/

Table of contents

Table of contents....................................................................................................................2

Credits.....................................................................................................................................3

Specifications.........................................................................................................................5

BGE Metabarcoding Workflow..............................................................................................6

FAVIS | Sample preparation and DNA extraction................................................................ 7

SECTION 1: Preparation.................................................................................................. 7

SECTION 2: Sample Processing.....................................................................................8

SECTION 3: DNA Purification..........................................................................................9

SECTION 4: Library preparation and Sequencing........................................................ 9

Amplicon library prep workflow | Custom protocol using the Freedom TECAN EVO

150 workstation.................................................................................................................... 11

1 PCR1 amplification of mitochondrial cytochrome c oxidase subunit I (COI) gene

region (418bp).................................................................................................................11

1.1 PCR1 Preparation.................................................................................................11

1.2 PCR1 Procedure.................................................................................................. 12

1.3 PCR1 products mixture........................................................................................ 13

2 Cleaning PCR1 products using magnetic beads (Clean1)...................................... 14

2.1 Clean1 preparation...............................................................................................14

2.2 Clean1 procedure.................................................................................................16

3 PCR2 indexing.............................................................................................................17

3.1 PCR2 Preparation................................................................................................ 17

3.2 PCR 2 procedure..................................................................................................17

4 Cleaning PCR indexing using magnetic beads (Clean2).........................................19

4.1 Clean 2 preparation..............................................................................................19

4.2 Clean 2 procedure................................................................................................19

5 Library preparation for sequencing...........................................................................21

5.1 Fluorescence quantification of the PCR plate...................................................... 21

5.2 Normalization and pooling....................................................................................21

Acknowledgments............................................................................................................... 23

References............................................................................................................................23

Credits

Name

Institution

PREPARED BY

Laura Najera Cortazar

Antonio J. Pérez

Delgado

Brent Emerson

BIOPOLIS Association – CIBIO, Research Centre in

Biodiversity and Genetic Resources [BIOPOLIS - CIBIO]

The Institute of Natural Products and Agrobiology - The

Spanish National Research Council [IPNA-CSIC]

REVIEWED BY

Antonio J. Pérez

Delgado

The Institute of Natural Products and Agrobiology - The

Spanish National Research Council [IPNA-CSIC]

Laura Najera Cortazar

BIOPOLIS Association – CIBIO, Research Centre in

Biodiversity and Genetic Resources [BIOPOLIS - CIBIO]

APPROVED BY

Brent Emerson

The Institute of Natural Products and Agrobiology - The

Spanish National Research Council [IPNA-CSIC]

Background

The

Biodiversity Genomics Europe (BGE) Consortium has the overriding aim of accelerating

the use of genomic science to enhance understanding of biodiversity, monitor biodiversity

change, and guide interventions to address its decline. The objective is to establish

functioning biodiversity genomics networks, data generation and pipelines to characterize

biodiversity, and to improve management intervention and biomonitoring programs by

practical application of genomic tools.

Within the

BGE project, in terrestrial field sampling, arthropods were sampled across Europe

to discover biodiversity and to assess pan-European patterns of species diversity and

community composition in key systems, using DNA barcoding (Hebert et al., 2003) and

metabarcoding (Taberlet et al., 2012) techniques. More specifically, the case study High

Mountain Systems (HMS) aimed establishing a baseline sampling in mountain ranges

across Europe to track biodiversity shifts associated with climate change; and the Pollinator

Communities (PC) case study aimed to set a baseline for future monitoring efforts on

pollinator temporal trends in European urban and agricultural habitats, to quantify differences

in pollinator community attributes between urban and agricultural habitats, and to identify

pollinator species traits associated with urban living.

For fieldwork of these studies, Malaise traps were used to sample arthropods bulk samples,

contained in ethanol. For the HMS case study, two Malaise traps (one for sampling and one

as back up) were placed in five altitudinal stages, to be collected each week, during 20

weeks. For the PC case study, a simultaneous paired sampling, one trap in an urban garden

and one in an agricultural field, was carried out on each selected site, during five weeks. For

more information about the arthropod bulk sampling with Malaise traps please consult the

BGE | High Mountain Systems - Arthropod sampling with Malaise traps Standard Operating

Procedure (SOP) (Najera-Cortazar et al., 2024a), and the

BGE | Pollinator Communities -

Malaise trap sampling

SOP (Najera-Cortazar et al., 2024b) in WorkflowHub (Gustafsson et

al., 2025).

For both BGE case studies laboratory work, the FAVIS: Fast and Versatile protocol for

metabarcoding of bulk Insect Samples (Iwaszkiewicz-Eggebrecht et al., 2023a; 2023b), a

non-destructive metabarcoding protocol optimized for high-throughput processing of bulk

arthropod samples, was used. We describe the modifications performed within the BGE

project, according to each step of the FAVIS protocol, and we include the detailed

instructions for using a modular robotic workstation for automated liquid handling and

sample processing (TECAN Freedom Evo 150) during library preparation. The protocol is

divided in four sections, and each section has different subsections and steps, format that

we will preserve within this document, in order to facilitate following the modifications

performed within the BGE lab work. Please consult alongside the full

FAVIS protocol

(Iwaszkiewicz-Eggebrecht et al., 2023a; 2023b) following the link provided, which includes

multiple resources to correctly follow the protocol.

Specifications

● Collecting bottle size was specified at the beginning of both case studies, in order to

have the adequate size and width of mouth to be compatible with the lab bottle

heated shaker (VWR Incu-Line ILS6). Partners were provided with bottles, and were

advised to buy the following model or similar:

500 mL Thermo Scientific™ Nalgene™

Wide-Mouth LDPE Bottles with Closure

● The sampling SOPs (Najera-Cortazar et al., 2024a, 2024b) provided to each partner

specified to use at least 96% ethanol for filling the bottles while sampling

● We did not include an identification label for the samples inside the bottles. The

information for each sample is contained in a QR code affixed to the outside of each

collection bottle. This way, we avoided handling the samples before the alcohol had

settled.

● For international shipping of Malaise trap samples, ethanol was decanted from each

bottle, leaving less than 10 mL per bottle. For more information about the shipping

process, please consult

Malaise traps - Bulk sample shipping instructions. Sufficient

ethanol was added upon arrival so that the sample is submerged. Bottles were stored

at -20°C before processing

● We did not use a pre-heating bath to preheat the insect bottles. We pre-heated

buffers and bottles with specimens independently in the dry oven. Once they reached

a working temperature of around 56º (after about an hour), we pooled the appropriate

volume of buffer and proteinase K to the samples..

● Sample bottles were sent with fresh ethanol, therefore, the FAVIS steps involving the

reuse of the original ethanol,were not performed.

● Each sample requires a bench working station approximately 30 cm wide. We

processed samples in batches of 22 + one lysis blank (negative control) for digestion.

● The lysate generated was transferred to a 50 ml Falcon tube and then transferred to

a 2 ml tube. The 2 ml tubes from each batch were kept for long-term storage at

-20°C.

● After four lysis batches, enough lysate-samples (92) were available for DNA

extraction using a Kingfisher Flex in 96 well plates format. Extractions were

performed with the commercial kit Omega BIO-TEK, using 200 ul of lysate.

● Library preparation will follow a two-step PCR, consistent with the procedure

described in FAVIS (Iwaszkiewicz-Eggebrecht et al., 2023a; 2023b), with some

modifications. We made two replicates of the first PCR (PCR1) per sample using

Qiagen Multiplex PCR Kit (100).

● Cycling conditions and primers remained the same as in FAVIS (primers BF3-BR2).

For the second PCR (PCR2), we used TaKaRa Ex Taq® DNA Polymerase Hot-Start,

which is the polymerase that we routinely use for bulk sample metabarcoding. We

carried out a second cleaning of PCR2 products. Finally, we measured and pooled

the samples.

● Up to 384 unique dual indexes (Nextera XT Index Kit; Illumina, San Diego, CA, USA)

were used to multiplex samples, allowing simultaneous sequencing in a single run.

● Samples were sequenced in Illumina NovaSeq 6000 platform (paired-end; 2x250 bp),

sequencing four plates simultaneously within a full run.

● Collections tubes with 50 ml of lysate per sample will be temporarily stored until

finalisation of the project, and 2 ml tubes per sample were kept for long-term storage.

BGE Metabarcoding Workflow

FAVIS | Sample preparation and DNA extraction

We followed the FAVIS protocol, but with some modifications, thus the implementation of the

BGE protocol should side the FAVIS protocol as the fundamental protocol. Below we list the

steps of the FAVIS protocol, indicating where relevant the changes made for the BGE project

workflow. Therefore, changes are described within each modified step only.

FAVIS: Fast and Versatile protocol for metabarcoding of bulk Insect Samples

(Iwaszkiewicz-Eggebrecht et al., 2023a; 2023b)

SECTION 1: Preparation

This step sets up five working (washing, working, spike-in, lysis and weighting) stations and

the use of a heating station; bulk samples are processed within their original bottle during the

complete preparation workflow. Please keep in mind that each sample (or batch of samples)

may come from different origins and they have been transported under different conditions.

Therefore, it is important to inspect each sample to assess if the bottle is intact and

arthropods are in good condition; and externally clean the bottles to remove additional

contaminants for the working stations.

1. Set up washing stations

2. Set up working stations

2.2 Each sample requires a bench working tray, approximately 30 cm wide. Samples will be

processed in batches of 22 + lysis blank (negative control) per day for digestion (if one

person is working alone). It is estimated that after four days, there will be enough

lysate-samples ready for DNA extraction using 96 well plates in the kingfisher robot.

3. Set up spike-in stations

Proceed to step 4 - As suggested by the protocol, this step was skipped, as there was no

need to add biological spike-ins to the samples.

4. Set up lysis buffer and proteinase K station

5. Set up weighing station

6. Preheat lysis buffer

SECTION 2: Sample Processing

7. Decant ethanol

For this study, there was no archive paper label placed inside any bottle, thus there

will not be any label to be removed. All metadata was taken during sampling and

recorded with

PlutoF and the PlutoF Go app (Abarenkov et al., 2010) under each

unique sample ID code

8. Wet weigh samples

Before closing the bottles, a termite was added as control, before weighting.

8.5 Not adding spike-ins, but adding a termite for control

9. Add biological spike-ins (OPTIONAL)

Not done for the BGE project

10. Adding lysis buffer and proteinase K

Inverted steps 10-11

11. Pre-heated buffers and bottles with specimens independently in a dry oven

Inverted steps 11-10

12. Incubate samples at 56°C in a shaking dry incubator

13. Measure EtOH concentration (OPTIONAL)

Not done for the BGE project

14. Decant lysate solution and preserve insect sample for long term storage

In the next steps we will decant the lysate solution to the lysate collecting bottle which will be

stored at -20°C for long term storage.

15. Take aliquot of the lysate for DNA purification (optional)

In the next steps we will transfer a 1.8 mL aliquot of the lysate to the 2 mL lysate microtube

which will be used as a working stock for DNA purification. If you will proceed with DNA

purification straight away you can save time by transferring the precise aliquot of lysate (225

μL if you use step 16 below or 390 μL if you use the alternative option 17) directly from the

lysate bottle into a deep well plate and proceed with DNA purification from step 16.2 or step

17 onwards. Dilute samples 1:8 using ultrapure water.

SECTION 3: DNA Purification

This step uses Omega Mag-Bind Blood and Tissue DNA HDQ 96 Kit (M6399) to isolate DNA

from lysed bulk samples using the KingFisher Flex.

16. For our project we purify a 200 µL aliquot of lysate from each sample using Omega

Mag-Bind Blood and Tissue DNA HDQ 96 Kit (M6399) on a King Fisher Flex 96 robot

(modifying the manufacturer's instructions). We have reduced the volumes by half

compared to the original protocol. The following table shows the volumes used in

each purification step.

Plate

Content

Volumen (μl) per sample

Plate 1

Lysate

200

Al Buffer

230

Binding Bead Mix

340 (320 HDQ Bind+20 MBP)

Plate 2

VHB Buffer

300

Plate 3

VHB Buffer

300

Plate 4

SPM Buffer

300

Plate 5

Elution Buffer

100

17. DNA purification using homemade magnetic beads - (ALTERNATIVE OPTION)

Before proceeding with this step, prepare Magnetic Bead Solution as described in the

"Materials" section.

SECTION 4: Library preparation and Sequencing

18. Library preparation using a two step PCR approach.

For amplicon library preparation we use a two-step PCR approach. In the first step (PCR 1)

we amplify the target gene: 418 base pairs of the mitochondrial cytochrome c oxidase

subunit I (COI) gene region. In the second step (PCR 2) we add the Illumina indexes to the

amplified sequences and fill up Illumina adapters. 18.1

Target

Group

Marker

Primer Sequences

TDa

Expected

Amplicon size*

Metazoa

BF3_P5

FWD:

TCGTCGGCAGCGTCAGATGTGTATAAGA

GACAGCCHGAYATRGCHTTYCCHCG

50º

90s

418bp

Metazoa

BR2_P7

REV:

GTCTCGTGGGCTCGGAGATGTGTATAAG

AGACAGCDGGRTGNCCRAARAAYCA

* Expected amplicon size = insert length + primer lengths + 3bp NNs (avg.).

19. Pooling strategy and sequencing

Because our inserts are ca. 462bp long (418bp region of interest, plus primers, plus

variable-length inserts), we require a sequencing platform providing reads with total length

>500 bp. NovaSeq SPrime 2x250bp flow cell is the most cost-effective solution at the time of

publishing this protocol. We sequence 768 libraries (8x96 well plates) per NovaSeq SPrime

2x250bp flow cell: 384 samples (4x96-well plates) pooled per lane. Before submitting

libraries for sequencing we create two Master Pools (A and B) composed of 384 libraries

each. Each Master pool is sequenced in 1 lane of a NovaSeq SPrime 2x250bp flow cell.

According to Illumina specifications, the NovaSeq SPrime 2x250bp should provide up to

800M read pairs per flow cell, but in our experience, 900M or more reads were often

obtained. This results in an average of >1M read pairs for each of 768 libraries sequenced

per flow cell.

20.

Spotlight video with authors Elzbieta Iwaszkiewicz-Eggebrecht and Andreia Miraldo

Amplicon library prep workflow | Custom

protocol using the Freedom TECAN EVO 150

workstation

The Tecan Freedom EVO® 150 (Tecan Austria GmbH, 2024) platform provides a robust and

automated solution for high-throughput library preparation in metabarcoding workflows.

Designed to streamline complex multi-step processes such as PCR amplification, indexing,

and clean-up, this system minimizes manual intervention while ensuring reproducibility and

accuracy.

1 PCR1 amplification of mitochondrial cytochrome c oxidase subunit I

(COI) gene region (418bp)

- Two PCR1 replicates, total volume 40 μL (26.25 mix, 8.75 extract)

- PCR1 master mix is performed manually as described below, but the master mix

and template DNA are dispensed robotically.

1.1 PCR1 Preparation

To prepare the master mix for a 96-well plate, use a 5 mL microcentrifuge tube

compatible with the robotic unit holder. Multiply the volumes below by 95 (as one well

of the plate is left empty for PCR2 negative control).

Consumables and reagents

Component

Volume (μL)

2 x Qiagen Multiplex

16.1

10μM CO1_BF3_P5 primer mix

3.5

10μM CO1_BR2_P5 primer mix

3.5

ddH2O

3.15

Master mix

26.25

+ DNA template

8.75

1.2 PCR1 Procedure

1. Dispense the PCR master mix and DNA extract into a plate compatible with the

thermal cycler. This procedure is replicated, such that two amplification plates are

produced, labelled as “MBC_BGE_PCR1.1” and “MBC_BGE_PCR1.2”.

Items

Quantity

96-well PCR plate, non-skirted

Box of 50 μL tips

Microcentrifuge tube 5mL

Adhesive object cover for PCR plate

The consumables and reagents used in this step are placed on work table 1 (Figure

1).

Figure 1. Work table 1. The position of each consumable is shown. Abbreviations: Waste,

container where used tips are discarded; Diti200-1, position of new 200 μL tips; Diti50-1,

position of new 50 μL tips; Shaker, shaker position; Sample plate, 96-well PCR with DNA

extract; PCR plate, plate with the final result.

2. Run PCR1 using the following conditions:

Step

Temp. (ºC)

Time (s)

Cycles

Initial denaturation

900

Denaturation

Annealing

Extension

Final extension

600

Store

∞

Note: Performed outside the robotic station.

3. Check point

Run PCR1 products on a 2.5% agarose gel (2 μL PCR product + 2 μL loading dye).

Note: Performed outside the robotic station.

1.3 PCR1 products mixture

Combine the two PCR1 replicates in a rigid 96-well PCR plate with skirt. The

resulting plate will contain 30 μL of PCR product (15 μL from each PCR1) labelled

“MBC_BGE_PCR1_pool”.

Consumables and reagents

Items

Quantity

96-well PCR plate, non-skirted

Box of 50 μL tips

Rigid 96-well PCR plate with skirt

Adhesive object cover for PCR plate

The consumables and reagents used in this step are placed on the work table 2

(Figure 2).

Figure 2. Work table 2. The position of each consumable is shown. Abbreviations: Waste,

container where used tips are discarded; Diti200-1, position of new 200 μL tips; Diti50-1,

position of new 50 μL tips; Shaker, shaker position; PCR1.1 and PCR1.2, PCR plates;

PCR1-pool, plate with the final result.

2 Cleaning PCR1 products using magnetic beads (Clean1)

This step will remove primer dimer and enzymes that may affect PCR2 (indexing).

The final result will be a 96-well PCR plate, without skirt, with the clean PCR1

product labelled as “MBC_BGE_Clean1.”

2.1 Clean1 preparation

- Prepare fresh aliquots of 80% EtOH.

- Keep magnetic beads at room temperature.

- Spin the plate with the samples to remove any air bubbles.

Consumables and reagents

Items

Quantity

96-well PCR plate, non-skirted

Rigid 96-well PCR plate with skirt

Box of 50 μL tips

Box of 200 μL tips

Elution buffer

35 μL/sample

80% EtOH

180 μL /sample x 2

Magnetic beads

22.5 μl/sample

Adhesive object cover for PCR plate

The consumables and reagents used in this step are placed on the work table 3

(Figure 3).

Figure 3. Work table 3. The position of each consumable is shown. Abbreviations:Tris, 25 mL

reagent reservoir with tris buffer; EtOH, 100 mL reagent reservoir with 80% ethanol; Beads, 25

mL reagent reservoir with magnet beads; Liqu…, container where waste liquids are dispensed;

Waste, container where used tips are discarded; Diti200-1, position of new 200 μL tips;

Diti50-1, position of new 50 μL tips; Shaker, shaker position; cover plate cover position;

Magnet, magnet position; Sample plate, rigid 96-well PCR plate with sample; Elution plate,

plate with the final result.

2.2 Clean1 procedure

1. Transfer 30 μL of PCR1 product to a rigid 96-well PCR plate with skirt and add

22.5 μL (x 0.75) of Magnetic Bead Solution, mix by pipetting and vortex the entire

plate using the plate shaker (1,800 rpm/1 min).

2. Incubate mixture for 300 s at room temperature.

3. Place the plate on a magnetic stand for 4 min.

4. Remove supernatant.

5. From a 100 mL reagent reservoir, transfer 180 μL of 80% EtOH to each well.

6. Incubate on a magnetic stand for 30 s.

7. Remove supernatant.

8. Repeat steps 5 – 7 above.

9. Wait 6 min. until the magnetic bead pellet is dry (on magnetic stand).

10. Remove samples from the magnetic stand, add 35 μL of Tris buffer, vortex the

entire plate using the plate shaker (1,800 rpm/1 min.), mix by pipetting up and

down and vortex again (1,800 rpm/1 min.). It is good to centrifuge the plate

before the next step.

11. Place the plate back on the magnetic stand for 5 min.

12. Transfer supernatant (30 μL) to a new 96-well plate, non-skirted.

13. Mark the plate with a unique identifier and store at 4ºC (for a few days) or at

-20ºC (for a longer period).

Note: rigid 96-well PCR plate, with skirt must be compatible with the robotic

manipulator arm so that they can be placed in different positions on the robotic unit

14. Check point (Optional)

Run PCR1 products on a 2.5% agarose gel (2 μL PCR product + 2 μL loading dye).

Note: Performed outside the robotic station.

3 PCR2 indexing

3.1 PCR2 Preparation

- PCR 2 master mix is performed manually as described below.

Consumables and reagents.

PCR2 Master Mix

Volume (μL) /sample

ddH2O

29.92

Buffer (NH4)

3.5

MgCl2

0.7

dNTPs

0.7

DNA polymerase

0.18

Total

3.2 PCR 2 procedure

1. Mix 35 μL of PCR2 master mix, 5 μL of clean PCR1 product, 5 μL of index i5, and

index i7 per sample. The final result will be a plate with the indexing PCR product

labelled “MBC_BGE_PCR_index”

Items

Quantity

96-well PCR plate, non-skirted

Box of 50 μL tips

Adhesive object cover for PCR plate

The consumables and reagents used in this step are placed on the work table 4

(Figure 4).

Figure 4. Work table 4. The position of each consumable is shown. Abbreviations: Waste,

container where used tips are discarded; Tube, Eppendorf tube with PCR master mix;

Diti200-1, position of new 200 μL tips; Diti50-1, position of new 50 μL tips; Shaker, shaker

position; cover, plate cover position; Magnet, magnet position; Primers, i5 and i7 index

support; Sample plate, rigid 96-well PCR plate with sample; PCR plate, plate with PCR

products.

2. Run PCR 2 using the following conditions.

Step

Temp. (ºC)

Time (s)

Cycles

Initial denaturation

900

Denaturation

Annealing

Extension

Final extension

600

Store

∞

Note: Performed outside the robotic station.

3. Check point (Optional)

Run clean PCR index products on a 2.5% agarose gel (2 μL PCR product + 2 μL

loading dye).

Note: Performed outside the robotic station.

4 Cleaning PCR indexing using magnetic beads (Clean2)

This step removes primer dimer and enzymes.

4.1 Clean 2 preparation

- Prepare fresh aliquots of 80% EtOH.

- Keep magnetic beads at room temperature.

- Spin the plate with the samples to remove any air bubbles.

Consumables and reagents

Items

Quantity

96-well PCR plate, non-skirted

Box of 50 μL tips

Box of 200 μL tips

Elution buffer

50 μL /sample

80% EtOH

180 μL /sample x 2

Magnetic beads

31.5 μL /sample

Adhesive object cover for PCR plate

The consumables and reagents used in this step are placed on the work table 5

(Figure 5).

Figure 5. Work table 5. The position of each consumable is shown. Abbreviations:Tris, 25 mL

reagent reservoir with tris buffer; EtOH, 100 mL reagent reservoir with 80% ethanol; Beads, 25

mL reagent reservoir with magnet beads; Liqu…, container where waste liquids are dispensed;

Waste, container where used tips are discarded; Diti200-1, position of new 200 μL tips;

Diti50-1, position of new 50 μL tips; Shaker , shaker position; cover, plate cover position;

Magnet, magnet position; Sample plate, rigid 96-well PCR plate; PCR-index, plate with sample;

Elution plate, plate with the final result.

4.2 Clean 2 procedure

1. Transfer 45 μL of PCR index product to a 96 deep-well plate and add 31.5 μL (x

0.7) of Magnetic Bead Solution, and mix by pipetting and vortex the entire plate

using the plate shaker (1,800 rpm/2 min.).

2. Incubate mixture for 5 min. at room temperature.

3. Place the plate on a magnetic stand for 4 min.

4. Remove supernatant.

5. From a 100 mL reagent reservoir, transfer 180 μL of 80% EtOH to each well.

6. Incubate on a magnetic stand for 30 s.

7. Remove supernatant.

8. Repeat steps 6 – 8 above.

9. Wait 6 min. until the magnetic bead pellet gets dry (on magnetic stand).

10. Remove samples from the magnetic stand, add 50 μL of Tris buffer, vortex the

entire plate using the plate shaker (1,800 rpm/1 min.), mix by pipetting up and

down and vortex again (1,800 rpm/1 min.). It is good to centrifuge the plate

before the next step.

11. Place back the plate on the magnetic stand for 5 min.

12. Transfer supernatant (45 μL) to a new 96-well plate.

13. Mark the plate with a unique identifier and store at 4ºC (for a few days) or at

-20ºC (for a longer period).

Note: 96-well PCR plate, non-skirted with clean PCR2 product labelled as

“MBC_XXX_Clean2”.

14. Check point

Run clean PCR index products on a 2.5% agarose gel (2 μL PCR product + 2 μL

loading dye).

Note: Performed outside the robotic station.

Library preparation for sequencing

Create a pool of samples by mixing PCR2 products in an 1.5 mL microtube, based

on DNA concentration of each library.

Consumables and reagents.

Items

Quantity

96-well PCR plate, non-skirted

Adhesive object cover for PCR plate

fluorescence buffer

200 μL/ sample

Box of 50 μL tips

1.5 mL Eppendorf tube

The consumables and reagents used in this step are placed on the work table 6

(Figure 6).

Figure 6. Work table 6. The position of each consumable is shown. Abbreviations: Waste,

container where used tips are discarded; SP…, Eppendorf tube with final pool; Diti200-1,

position of new 200 μL tips; Diti50-1, position of new 50 μL tips; Sample plate, clean PCR2

product.

5.1 Fluorescence quantification of the PCR plate

Operation performed manually

5.2 Normalization and pooling

Dispense the determined volume into the Eppendorf tube so that each sample has

the same concentration, resulting in a 1.5 mL tube with equivalent molarities for each

library labelled “MBC_XXX.”

Acknowledgments

Biodiversity Genomics Europe (Grant no.101059492) is funded by Horizon Europe under the

Biodiversity, Circular Economy and Environment call (REA.B.3); co-funded by the Swiss

State Secretariat for Education, Research and Innovation (SERI) under contract numbers

22.00173 and 24.00054; and by the UK Research and Innovation (UKRI) under the

Department for Business, Energy and Industrial Strategy’s Horizon Europe Guarantee

Scheme.

References

● Abarenkov, K., Tedersoo, L., Nilsson, R. H., Vellak, K., Saar, I., Veldre, V., Parmasto,

E., Prous, M., Aan, A., Ots, M., Kurina, O., Ostonen, I., Jõgeva, J., Halapuu, S.,

Põldmaa, K., Toots, M., Truu, J., Larsson, K-H., and Kõljalg, U. 2010. PlutoF - a web

based workbench for ecological and taxonomic research, with an online

implementation for Fungal ITS sequences. Evolutionary Bioinformatics, 6, 189 - 196.

● Gustafsson, O. J. R., Wilkinson, S. R., Bacall, F. et al. WorkflowHub: a registry for

computational workflows. Sci Data 12, 837 (2025).

https://doi.org/10.1038/s41597-025-04786-3

● Hebert, P. D., Cywinska, A., Ball, S. L., and deWaard, J. R. 2003. Biological

identifications through DNA barcodes. Proc Biol Sci. 7,270(1512):313-21.

https://doi.org/10.1098/rspb.2002.2218

● Iwaszkiewicz-Eggebrecht, E., Łukasik, P., Buczek, M., Deng, J., Hartop, E. A., H.

Havnås, H., Prus-Frankowska, M., Ugarph, C. R., Viteri, P., Andresson, A. F., Roslin,

T., Tack, A. J. M., Ronquist, F., Miraldo, A., and Łukasik, P. 2023a. FAVIS: Fast and

versatile protocol for non-destructive metabarcoding of bulk insect samples. PLOS

ONE 18(7): e0286272.

https://doi.org/10.1371/journal.pone.0286272

● Iwaszkiewicz-Eggebrecht, E., Łukasik, P., Buczek, M., Deng, J., Hartop, E. A., H.

Havnås, H., Prus-Frankowska, M., Ugarph, C. R., Viteri, P., Andresson, A. F., Roslin,

T., Tack, A. J. M., Ronquist, F., Miraldo, A., and Łukasik, P. 2023b. FAVIS: Fast and

Versatile protocol for metabarcoding of bulk Insect Samples from large-scale diversity

monitoring projects,

protocols.io,

https://dx.doi.org/10.17504/protocols.io.kqdg36261g25/v2

● Najera-Cortazar, L. A., Ferreira, S., Mata, V., and Beja, P. 2024a. Biodiversity

Genomics Europe | High Mountain Systems - Arthropod sampling with Malaise traps.

WorkflowHub,

https://workflowhub.eu/sops/17?version=3

● Najera-Cortazar, L., Ferreira, S., and Beja, P. 2024b. Biodiversity Genomics Europe |

Pollinator Communities - Malaise trap sampling. WorkflowHub.

https://doi.org/10.48546/WORKFLOWHUB.SOP.18.1

● Taberlet, P., Coissac, E., Hajibabaei, M., and Rieseberg, L. H. 2012. Environmental

DNA. Mol. Ecol., 21: 1789-1793.

https://doi.org/10.1111/J.1365-294x.2012.05542.X.