.. |logo_BGE_alpha| image:: _static/logo_BGE_alpha.png :width: 300 :alt: Alternative text :target: https://biodiversitygenomics.eu/ .. |eufund| image:: _static/eu_co-funded.png :width: 200 :alt: Alternative text .. |chfund| image:: _static/ch-logo-200x50.png :width: 210 :alt: Alternative text .. |ukrifund| image:: _static/ukri-logo-200x59.png :width: 150 :alt: Alternative text .. |primer_constructs| image:: _static/primer_constructs.png :width: 750 :alt: Alternative text :class: center .. |logo_BGE_small| image:: _static/logo_BGE_alpha.png :width: 120 :alt: Alternative text :target: https://biodiversitygenomics.eu/ .. raw:: html .. role:: red .. _amplicon18S: |logo_BGE_alpha| 18S *** Amplicon library preparation for 18S rRNA V4 region to target **eukaryotic communities** using **2-step PCR** with primers **TAReuk454FWD1** (CCAGCASCYGCGGTAATTCC) and **TAReukREV3** (ACTTTCGTTCTTGATYRA) [`Stoeck et al. 2010 `_]. *Besides used primers and the PCR conditions for the 1st PCR, the protocol in identical to* :ref:`ITS2 ` *and* :ref:`COI ` *library prep.* .. admonition:: Primer constructs for 1st PCR +-----------------------------------+----------+----------------------+ | Forward sequencing adaptor site | Shifter* | Forward primer | +===================================+==========+======================+ | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | NNNNNN | CCAGCASCYGCGGTAATTCC | +-----------------------------------+----------+----------------------+ +------------------------------------+---------+--------------------+ | Reverse sequencing adaptor site | Shifter*| Reverse primer | +====================================+=========+====================+ | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG | NNNNN | ACTTTCGTTCTTGATYRA | +------------------------------------+---------+--------------------+ \* Shifter is 0-6 bp .. admonition:: Indexing primer constructs for 2nd PCR (indexing PCR) with overhangs to sequencing adaptor sites: +-------------------------------+---------+------------------+ | P5 (forward) adapter | Index | Forward overhang | +===============================+=========+==================+ | AATGATACGGCGACCACCGAGATCTACAC | NNNNNNN | TCGTCGGCAGCGTC | +-------------------------------+---------+------------------+ +--------------------------+---------+------------------+ | P7 (reverse) adapter | Index | Reverse overhang | +==========================+=========+==================+ | CAAGCAGAAGACGGCATACGAGAT | NNNNNNN | GTCTCGTGGGCTCGG | +--------------------------+---------+------------------+ Full construct: |primer_constructs| ___________________________________________________ 1st PCR ------- **Consumables:** +------------------------+-----------------+-------------+-----------+ | Items | Initial | Quantity | Storage | | | Concentration | | | +========================+=================+=============+===========+ | eDNA *(dilution | 10 ng/µL | 2 µL per | -15° to | | plate)* | | sample | -25°C | +------------------------+-----------------+-------------+-----------+ | Amplicon PCR Forward | 10 µM | 0.25 µL per | -15° to | | Primer | | sample | -25°C | +------------------------+-----------------+-------------+-----------+ | Amplicon PCR Reverse | 10 µM | 0.25 µL per | -15° to | | Primer | | sample | -25°C | +------------------------+-----------------+-------------+-----------+ | Qiagen Master Mix | 5x | 5 µL per | -15° to | | | | sample | -25°C | +------------------------+-----------------+-------------+-----------+ | Ultrapure water | | 2.5 µL per | | | | | sample | | +------------------------+-----------------+-------------+-----------+ | 96-well 0.2 mL PCR | | 1 plate | | | plate | | | | +------------------------+-----------------+-------------+-----------+ Total volume per PCR reaction = **10µL**. **PCR conditions:** +----------------------+------------+ | 95ºC for 15 minutes | | +----------------------+------------+ || 94ºC for 30 seconds || | || 57ºC for 45 seconds || 10 cycles | || 72ºC for 60 seconds || | +----------------------+------------+ || 94ºC for 30 seconds || | || 48ºC for 45 seconds || 25 cycles | || 72ºC for 60 seconds || | +----------------------+------------+ | 72ºC for 10 minutes | | +----------------------+------------+ | Hold at 10ºC | | +----------------------+------------+ **Expected amplicon size = 435 bp** (with primers). ● Test the PCR success of all samples through electrophoresis of 2 µL using 2% agarose gel. ● Dilute samples 1:4 using ultrapure water. ___________________________________________________ 2nd PCR (indexing PCR) ---------------------- **Consumables:** +-------------------------------+----------------+-------------------+---------------+ || Items || Initial || Quantity || Storage | || || Concentration || || | +-------------------------------+----------------+-------------------+---------------+ | PCR 1 (*diluted* 1:4) | *n.i.* | 2.8 µL per sample | -15° to -25°C | +-------------------------------+----------------+-------------------+---------------+ | P5-P7 Index Primer Mix | 10 µM | 1.4 µL per sample | -15° to -25°C | +-------------------------------+----------------+-------------------+---------------+ | KAPA HiFi Hot-Start Ready Mix | 2x | 7 µL per sample | -15° to -25°C | +-------------------------------+----------------+-------------------+---------------+ | H2O | | 2.8 µL per sample | | +-------------------------------+----------------+-------------------+---------------+ | 96-well 0.2 mL PCR plate | | 1 plate | | +-------------------------------+----------------+-------------------+---------------+ **Procedure:** 1. Transfer **1.4 µL** of each mixed combination of P5 and P7 indexing primers to a new plate. 2. Set up the following reaction per sample: +-------------------------------+------------+ | | 1X | +===============================+============+ | KAPA HiFi Hot-Start Ready Mix | 7 µL | +-------------------------------+------------+ | H2O | 2.8 µL | +-------------------------------+------------+ | Total | **9.8 µL** | +-------------------------------+------------+ 3. Mix the reagents by pipetting, spin down and distribute it in each well. 4. Add **2.8 µL** of the diluted PCR1 product. 5. Seal plate and perform PCR in a thermal cycler using the following conditions: +----------------------+-----------+ | 95ºC for 3 minutes | | +----------------------+-----------+ || 95ºC for 30 seconds || | || 55ºC for 30 seconds || 8 cycles | || 72ºC for 30 seconds || | +----------------------+-----------+ | 72ºC for 5 minutes | | +----------------------+-----------+ | Hold at 10ºC | | +----------------------+-----------+ 6. Test size shift between PCR1 and PCR2 amplicons of ~15% of samples (e.g. 4 sets of 4 samples selected from random rows) through electrophoresis in 2% agarose gel. ___________________________________________________ Clean PCR products ------------------ This step uses magnetic beads to purify PCR products from free primers and primer-dimers. **Equipment and consumables:** +----------------------------------------+---------------+------------+ | Items | Quantity | Storage | +========================================+===============+============+ | Qiagen EB Buffer | 25 µL per | 15ºC - | | | sample | 25ºC | +----------------------------------------+---------------+------------+ | KAPA HyperPure Beads | 8 µL per | 4ºC | | | sample | | +----------------------------------------+---------------+------------+ | Freshly prepared 80% ethanol (EtOH) | 300 µL per | | | | sample | | +----------------------------------------+---------------+------------+ | Cell culture plate *(new)* | 4 plates | | +----------------------------------------+---------------+------------+ | 96-well PCR plate Non-skirted (VWR) | 1 plate | | +----------------------------------------+---------------+------------+ | Reservoirs | 1 | | +----------------------------------------+---------------+------------+ | Magnetic Bead Extractor for 96 Well | 1 | | | Microplates (V&P Scientific) | | | +----------------------------------------+---------------+------------+ | Low-bind microplate (Optional) | 1 | | +----------------------------------------+---------------+------------+ **Preparation:** - Bring the **KAPA HyperPure beads** to room temperature for **30min** prior to usage; - Prepare **fresh 80% ethanol**; - Aliquot the EB Buffer and protect from any direct light source; - Short spin the Amplicon PCR plate to collect condensation; - Clean the working space and material with disinfectant and ethanol; - Sterilize, under UV light for about **15min**, four U-bottom 96-well plates, a falcon with freshly prepared 80% ethanol and EB Buffer. **Procedure:** 1. Distribute the appropriate volume of beads in one of the U-bottom 96-well plates (*U-plate 1*). *Note: The volume of beads may depend on the ratio chosen, which varies according to library size. A standard ratio of 0,8x is used, adding 8 µL of beads for 10 µL of sample.* 2. Transfer the full PCR volume (10 µL) into the plate containing the KAPA HyperPure Beads, carefully pipetting the entire volume **up and down 10 times**. 3. Incubate at room temperature without shaking for **3 min**. 4. While in waiting, prepare three more U-bottom 96-well plates as following: two plates with **150µL 80% ethanol** and one plate with **40µL EB Buffer**. 5. Gently place a 96-well PCR plate on the plate from step 2 and attach the magnetic bead separation extractor for **2 minutes** or until the supernatant is cleared. 6. Carefully remove the extractor and submerge the beads into one of the plates with freshly prepared 80% ethanol (*U-plate 2*) for **30s**. 7. Carefully remove the extractor and perform a second ethanol wash (*U-plate 3*). 8. Allow the beads to air-dry for **6-7min**. .. Note: Do not over-dry the beads, if they start to appear cracked immediately proceed to the next step. 9. Carefully immerse the beads into the Tris buffer (*U-plate 4*) and release the PCR plate from the extractor. 10. Carefully resuspend the beads in Tris. 11. Attach the magnetic extractor to the PCR plate for **2 minutes** or until the supernatant is cleared. 12. Carefully remove the magnetic extractor and seal the U-bottom plate (or transfer it to a new low-bind PCR plate). ___________________________________________________ Pooling & quantification ------------------------ **Consumables:** +-----------------------------------------------------------------------+ | Items | +=======================================================================+ | Qiagen EB Buffer | +-----------------------------------------------------------------------+ | KAPA HyperPure Beads | +-----------------------------------------------------------------------+ | 96-well 0.2 mL PCR plate | +-----------------------------------------------------------------------+ | KAPA Library Quantification Kit (Roche) | +-----------------------------------------------------------------------+ | Tapestation High Sensitivity D5000 (Agilent) | +-----------------------------------------------------------------------+ | Qubit HS (Themo Fisher Scientific) | +-----------------------------------------------------------------------+ **Procedure:** 1. Quantify each library using spectrophotometry (e.g Nanodrop) to estimate average library concentration (ng/µL). 2. Pool libraries equimolarly at 45 ng by taking the corresponding uL from each library. The negative controls should be added at a maximum volume than any other single library (up to 20 µL). *Note: In cases where the sample does not have volume to take 45 ng, use the smallest common concentration available* 3. Clean the pool with KAPA HyperPure Beads (optional). *Note: The volume of beads may depend on the ratio chosen, which varies according to library size. A ratio of 0,7x can be used, adding 70 µL of beads for 100 µL of sample.* 4. Quantify library pool using *KAPA Library Quantification Kit* for qPCR, Qubit or Tapestation. 5. Dilute each library pool using Buffer EB according to specifications by sequencing provider (if needed). 6. Verify the final concentration of a library pool using *KAPA Library Quantification Kit* in qPCR. ___________________________________________________ **References** Chaves, C., Najera Cortazar, L. A., Martins, F., Veríssimo, J., Dunshea, G., & Price, B. (2025). Detection of Non-Indigenous Marine Species from Port Water Samples. WorkflowHub. https://doi.org/10.48546/workflowhub.sop.11.2 ___________________________________________________ |logo_BGE_small| |eufund| |chfund| |ukrifund|