.. |logo_BGE_alpha| image:: _static/logo_BGE_alpha.png
:width: 300
:alt: Alternative text
:target: https://biodiversitygenomics.eu/
.. |eufund| image:: _static/eu_co-funded.png
:width: 200
:alt: Alternative text
.. |chfund| image:: _static/ch-logo-200x50.png
:width: 210
:alt: Alternative text
.. |ukrifund| image:: _static/ukri-logo-200x59.png
:width: 150
:alt: Alternative text
.. |primer_constructs| image:: _static/primer_constructs.png
:width: 750
:alt: Alternative text
:class: center
.. |logo_BGE_small| image:: _static/logo_BGE_alpha.png
:width: 120
:alt: Alternative text
:target: https://biodiversitygenomics.eu/
.. raw:: html
.. role:: red
.. _amplicon16S:
|logo_BGE_alpha|
16S
***
Amplicon library preparation for 16S rRNA V4 region to target **bacterial communities** using **2-step PCR**
with primers **515F** (GTGYCAGCMGCCGCGGTAA; `Parada et al., 2016 `_)
and **926R** (CCGYCAATTYMTTTRAGTTT; `Quince et al., 2010 `_).
Herein processes follow lab SOP for the 'Characterization of Prokaryotic and
Eukaryotic Biodiversity from Soil Samples' (Chaves et al., 2025);
the workflow is hosted in `WorkflowHub `_
*(hosts the downloadable PDF).*
*Besides used primers and the PCR conditions for the 1st PCR, the protocol in identical to* :ref:`ITS2 ` *and* :ref:`COI ` *library prep.*
.. admonition:: Primer constructs for 1st PCR
+-----------------------------------+----------+---------------------+
| Forward sequencing adaptor site | Shifter* | Forward primer |
+===================================+==========+=====================+
| TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | NNNNNN | GTGYCAGCMGCCGCGGTAA |
+-----------------------------------+----------+---------------------+
+------------------------------------+---------+----------------------+
| Reverse sequencing adaptor site | Shifter*| Reverse primer |
+====================================+=========+======================+
| GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG | NNNNN | CCGYCAATTYMTTTRAGTTT |
+------------------------------------+---------+----------------------+
\* Shifter is 0-6 bp
.. admonition:: Indexing primer constructs for 2nd PCR (indexing PCR) with overhangs to sequencing adaptor sites:
+-------------------------------+---------+------------------+
| P5 (forward) adapter | Index | Forward overhang |
+===============================+=========+==================+
| AATGATACGGCGACCACCGAGATCTACAC | NNNNNNN | TCGTCGGCAGCGTC |
+-------------------------------+---------+------------------+
+--------------------------+---------+------------------+
| P7 (reverse) adapter | Index | Reverse overhang |
+==========================+=========+==================+
| CAAGCAGAAGACGGCATACGAGAT | NNNNNNN | GTCTCGTGGGCTCGG |
+--------------------------+---------+------------------+
Full construct:
|primer_constructs|
___________________________________________________
1st PCR
-------
**Consumables:**
+------------------------+-----------------+-------------+-----------+
| Items | Initial | Quantity | Storage |
| | Concentration | | |
+========================+=================+=============+===========+
| eDNA *(dilution | 10 ng/µL | 2 µL per | -15° to |
| plate)* | | sample | -25°C |
+------------------------+-----------------+-------------+-----------+
| Amplicon PCR Forward | 10 µM | 0.25 µL per | -15° to |
| Primer | | sample | -25°C |
+------------------------+-----------------+-------------+-----------+
| Amplicon PCR Reverse | 10 µM | 0.25 µL per | -15° to |
| Primer | | sample | -25°C |
+------------------------+-----------------+-------------+-----------+
| Qiagen Master Mix | 5x | 5 µL per | -15° to |
| | | sample | -25°C |
+------------------------+-----------------+-------------+-----------+
| Ultrapure water | | 2.5 µL per | |
| | | sample | |
+------------------------+-----------------+-------------+-----------+
| 96-well 0.2 mL PCR | | 1 plate | |
| plate | | | |
+------------------------+-----------------+-------------+-----------+
Total volume per PCR reaction = **10µL**.
**PCR conditions:**
+----------------------+------------+
| 95ºC for 15 minutes | |
+----------------------+------------+
|| 95ºC for 45 seconds || |
|| 50ºC for 45 seconds || 30 cycles |
|| 72ºC for 90 seconds || |
+----------------------+------------+
| 72ºC for 10 minutes | |
+----------------------+------------+
| Hold at 10ºC | |
+----------------------+------------+
**Expected amplicon size = 584 bp** *(insert length (~472 bp) + primer lengths + 6bp NNs (avg.) + 67bp overhangs).*
● Test the PCR success of all samples through electrophoresis of 2 µL using 2% agarose gel.
● Dilute samples 1:4 using ultrapure water.
___________________________________________________
2nd PCR (indexing PCR)
----------------------
**Consumables:**
+-------------------------------+----------------+-------------------+---------------+
|| Items || Initial || Quantity || Storage |
|| || Concentration || || |
+-------------------------------+----------------+-------------------+---------------+
| PCR 1 (*diluted* 1:4) | *n.i.* | 2.8 µL per sample | -15° to -25°C |
+-------------------------------+----------------+-------------------+---------------+
| P5-P7 Index Primer Mix | 10 µM | 1.4 µL per sample | -15° to -25°C |
+-------------------------------+----------------+-------------------+---------------+
| KAPA HiFi Hot-Start Ready Mix | 2x | 7 µL per sample | -15° to -25°C |
+-------------------------------+----------------+-------------------+---------------+
| H2O | | 2.8 µL per sample | |
+-------------------------------+----------------+-------------------+---------------+
| 96-well 0.2 mL PCR plate | | 1 plate | |
+-------------------------------+----------------+-------------------+---------------+
**Procedure:**
1. Transfer **1.4 µL** of each mixed combination of P5 and P7 indexing primers to a new plate.
2. Set up the following reaction per sample:
+-------------------------------+------------+
| | 1X |
+===============================+============+
| KAPA HiFi Hot-Start Ready Mix | 7 µL |
+-------------------------------+------------+
| H2O | 2.8 µL |
+-------------------------------+------------+
| Total | **9.8 µL** |
+-------------------------------+------------+
3. Mix the reagents by pipetting, spin down and distribute it in each well.
4. Add **2.8 µL** of the diluted PCR1 product.
5. Seal plate and perform PCR in a thermal cycler using the following conditions:
+----------------------+-----------+
| 95ºC for 3 minutes | |
+----------------------+-----------+
|| 95ºC for 30 seconds || |
|| 55ºC for 30 seconds || 8 cycles |
|| 72ºC for 30 seconds || |
+----------------------+-----------+
| 72ºC for 5 minutes | |
+----------------------+-----------+
| Hold at 10ºC | |
+----------------------+-----------+
6. Test size shift between PCR1 and PCR2 amplicons of 15% of samples (e.g. 4 sets of 4 samples selected from random rows) through electrophoresis in 2% agarose gel.
___________________________________________________
Clean PCR products
------------------
This step uses magnetic beads to purify PCR products from free primers and primer-dimers.
**Equipment and consumables:**
+----------------------------------------+---------------+------------+
| Items | Quantity | Storage |
+========================================+===============+============+
| Qiagen EB Buffer | 25 µL per | 15ºC - |
| | sample | 25ºC |
+----------------------------------------+---------------+------------+
| KAPA HyperPure Beads | 8 µL per | 4ºC |
| | sample | |
+----------------------------------------+---------------+------------+
| Freshly prepared 80% ethanol (EtOH) | 300 µL per | |
| | sample | |
+----------------------------------------+---------------+------------+
| Cell culture plate *(new)* | 4 plates | |
+----------------------------------------+---------------+------------+
| 96-well PCR plate Non-skirted (VWR) | 1 plate | |
+----------------------------------------+---------------+------------+
| Reservoirs | 1 | |
+----------------------------------------+---------------+------------+
| Magnetic Bead Extractor for 96 Well | 1 | |
| Microplates (V&P Scientific) | | |
+----------------------------------------+---------------+------------+
| Low-bind microplate (Optional) | 1 | |
+----------------------------------------+---------------+------------+
**Preparation:**
- Bring the **AMPure XP beads** to room temperature for **30min** prior
to usage;
- Prepare **fresh 80% ethanol**;
- Prepare a 50mL tube with EB Buffer and protect from any direct light
source;
- Short spin the Amplicon PCR plate to collect condensation;
- Clean the working space and material with disinfectant and ethanol;
- Sterilize, under UV light for about **15min**, four U-bottom 96-well
plates, a falcon with freshly prepared 80% ethanol and EB Buffer.
**Procedure:**
1. Distribute the appropriate volume of beads in one of the U-bottom
96-well plates (*U-plate 1*).
*Note: The volume of beads may depend on the ratio chosen,
which varies according to library size.
A standard ratio of 0,8x is used, adding 8 µL of beads for 10 µL of sample.*
2. Transfer the full PCR volume (10 µL) into the plate containing the
KAPA HyperPure Beads, carefully pipetting the entire volume **up and
down 10 times**.
3. Incubate at room temperature without shaking for **3 min**.
4. While in waiting, prepare three more U-bottom 96-well plates as
following: two plates with **150µL 80% ethanol** and one plate with
**25µL EB Buffer**.
5. Gently place a 96-well PCR plate on the plate from step 2 and attach
the magnetic bead separation extractor for **2min** or until the
supernatant is cleared.
6. Carefully remove the extractor and submerge the beads into one of the
plates with freshly prepared 80% ethanol (*U-plate 2*) for **30s**.
7. Carefully remove the extractor and perform a second ethanol wash
(*U-plate 3*).
8. Allow the beads to air-dry for **6-7min**.
..
Note: Do not over-dry the beads, if they start to appear cracked
immediately proceed to the next step.
9. Carefully immerse the beads into the EB buffer (*U-plate 4*) and
release the PCR plate from the extractor.
10. Carefully resuspend the beads in EB buffer.
11. Attach the magnetic extractor to the PCR plate for **2min** or until
the supernatant is cleared.
12. Carefully remove the magnetic extractor and seal the U-bottom plate
(or transfer it to a new low-bind PCR plate).
___________________________________________________
Pooling & quantification
------------------------
**Consumables:**
+-----------------------------------------------------------------------+
| Items |
+=======================================================================+
| Qiagen EB Buffer |
+-----------------------------------------------------------------------+
| KAPA HyperPure Beads |
+-----------------------------------------------------------------------+
| 96-well 0.2 mL PCR plate |
+-----------------------------------------------------------------------+
| KAPA Library Quantification Kit (Roche) |
+-----------------------------------------------------------------------+
| Tapestation High Sensitivity D5000 (Agilent) |
+-----------------------------------------------------------------------+
| Qubit HS (Themo Fisher Scientific) |
+-----------------------------------------------------------------------+
**Procedure:**
1. Quantify each library using spectrophotometry (e.g Nanodrop) to estimate average library concentration (ng/µL).
2. Pool libraries equimolarly at 50 ng by taking the corresponding uL
from each library. The negative controls should be added at a maximum
volume than any other single library (up to 20 µL).
*Note: In cases where the sample does not have volume to take 50ng, use the smallest common concentration available*
3. Clean the pool with KAPA HyperPure Beads.
*Note: The volume of beads may depend on the ratio chosen,
which varies according to library size. A ratio of 0,7x can be used, adding 70 µL of beads for 100 µL of sample.*
4. Quantify library pool using *KAPA Library Quantification Kit* for qPCR, Qubit or Tapestation.
5. Dilute each library pool using Buffer EB according to specifications by sequencing provider (if needed).
6. Verify the final concentration of a library pool using *KAPA Library Quantification Kit* in qPCR.
___________________________________________________
**References**
Chaves, C., Najera Cortazar, L. A., Martins, F., Anslan, S., Beja-Pereira, A., Magalhães, M., & Price, B. (2025). Characterization of Prokaryotic and Eukaryotic Biodiversity from Soil Samples. WorkflowHub. https://doi.org/10.48546/workflowhub.sop.12.2
___________________________________________________
|logo_BGE_small| |eufund| |chfund| |ukrifund|